Lectin perfused and pericytes covered tumor blood vessels are shown as % of the total intratumoral vessels. To determine tumor cell proliferation and apoptosis, BrdU/TUNEL/or Ki67 positive nuclei were counted in randomly chosen 40�� Crenolanib magnification fields of tumor tissue. Per mouse approximately 10 fields were examined. Microvessel diameter and length were quantified in C57Bl/6 (n=233 vessel structures), RIP1-VEGFB (n=254 vessel structures), RIP1-Tag2 (n=2034 vessel structures), RIP1-Tag2; RIP1-VEGFB (n=1811 vessel structures), RIP1-Tag2; Vegfb+/? (n=2806 vessel structures), and RIP1-Tag2; Vegfb?/? (n=1775 vessel structures) using the Volocity Quantitation software package Perkin-Elmer, Waltham, MA). Vessel diameter was taken as object area divided by skeletal length.
RT-PCR A single cell suspension of pancreatic tumors of 12 -week -old RIP1-Tag2 mice was prepared by Dispase digestion. For subsequent isolation of GLP-1R+ ��-tumor cells and tumor-derived CD31+ blood endothelial cells (BEC) by fluorescence-activated cell sorting (FACS), cells were stained with FITC labeled glucagon-like peptide 1 receptor (GLP-1R) peptide ligand exendin-4 (Phoenix Pharmaceuticals, Inc.) and with APC-CD31 (Biolegend). Total RNA was extracted from isolated cells, cDNA prepared and the expression of VEGF-R1 was evaluated by PCR. The following primers were used: mActin: ACACTGTGCCCATCTACGAGG and CATGCATGCCACAGGATTCC mCD31: GGAGTCAGAACCCATCAGGA and TACTGGGCTTCGAGAGCATT mGLP-1R: TCAGAGACGGTGCAGAAATG and CAAGGCGGAGAAAGAAAGTG mVEGF-R1: CGGCAGACCAATACAATCCT and CCGCTGCCTTATAGATGCTC.
Quantitative RT-PCR Total RNA was extracted from isolated pancreatic tumors of RIP1-Tag2 and RIP1-Tag2; RIP1-VEGFB mice using TRIzol reagent. After DNase treatment of the RNA, first-strand cDNA was synthesized with M-MLV reverse transcriptase RNAse-H (Promega). Quantitative PCR for mouse Fatp1, 3, 4, Bik, Bmf, VEGF-A, PlGF, PDGF-BB, FGF2 and Ang2 transcripts was done on ABI Prism 7000 (Applied Biosystems) using the SYBR-green PCR MasterMix (Applied Biosystems) and normalized versus the mouse ribosomal protein 19 (mRPL19) transcript. The following primers were used: mRPL19: ATCCGCAAGCCTGTGACTGT and TCGGGCCAGGGTGTTTTT mVEGF-A: ACTGGACCCTGGCTTTACTG and TCTGCTCTCCTTCTGTCGTG mPlGF: CTGGGTTGGCTGTGCATT and GGCACCACTTCCACTTCTGT mPDGF-BB: CGAGGGAGGAGGAGCCTA and GTCTTGCACTCGGCGATTA mFGF2: CGGCTCTACTGCAAGAACG and TGCTTGGAGTTGTAGTTTGACG mAng2: CACACTGACCTTCCCCAACT and CCCACGTCCATGTCACAGTA mVEGFR1: ACCTCCGTGCATGTGTATGA and ATGGACAGCCGATAGGAC mVEGFR2: AAAGCGGGACGAGGAGAG and CAGGTTGCACAGTAATTTCAG.
Collagen Gel Assay Islets from C57BL/6, RIP1-VEGFA and RIP1-VEGFB mice or dysplastic islets from RIP1-Tag2 and RIP1-Tag2; RIP1-VEGFB mice were isolated Carfilzomib at the age of 6 and 9 weeks respectively as previously described [51].