, 2006). Crosslinking experiments were performed in transfected HEK293T cells and were induced with 0.008% glutaraldehyde after membrane recruitment of Munc13 with phorbol esters. Detailed experimental protocols are in the Supplemental Information. Cultured neurons were fixed in 4% paraformaldehyde/phosphate-buffered

saline, permeabilized in 0.1% Triton X-100/3% bovine serum albumin/phosphate-buffered saline, and incubated overnight with anti-Munc13 rabbit polyclonal antibodies (antibody 41, 1:2000) or anti-ubMunc13-2 rabbit polyclonal antibodies (antibody 52, 1:2000), and anti-synapsin mouse monoclonal antibodies (Synaptic Systems, 1:1000). Alexa-Fluor 546 anti-mouse and Alexa-Fluor 633 anti-rabbit secondary antibodies were used

for detection. Images were acquired with a Leica TCS2 BMS-754807 mw confocal microscope with identical settings applied to all samples in an experiment. Single confocal sections were recorded at 1 airy unit pinhole. The Munc13-1 KD sequence (KD91, GCCTGAGATCTTCGAGCTTAT) was expressed from an H1 promotor sequence in a lentiviral vector and PLX-4720 was followed by a ubiquitin promoter-driven mCherry. Munc13-deficient neurons were generated by Munc13-1 knockdown in Munc13-2 constitutive knockout neurons (Varoqueaux et al., 2002). Munc13-2 knockout neurons expressing mCherry but not Munc13-1 KD shRNA were used as control neurons. SDS/PAGE gels and immunoblotting were done according to standard methods described

in the Supplemental Information (Kaeser et al., 2009 and Kaeser et al., 2008). In all experiments, the experimenter was blind to the condition and/or genotype. All animal experiments were performed according to institutional guidelines. All data are shown as means ± standard error of the mean (SEM). Statistical significance first was determined by one-way analysis of variance (ANOVA) (electrophysiological recordings) or Student’s t test (all other experiments). All numerical and statistical values and the tests used can be found in the Tables S1–S8. We thank H. Ly for technical assistance, Dr. Nils Brose for the gift of Munc13-antibodies and Munc13-2 KO mice, Dr. Z. Pang for the ubMunc13-2ΔC2A construct, and members of the Südhof lab for comments. This work was supported by grants from the National Institites of Health (NINDS 33564 to T.C.S., DA029044 to P.S.K.), and by a Swiss National Science Foundation Postdoctoral Fellowship (to P.S.K.). “
“The extracellular fluid (ECF) osmolality is tightly regulated in mammals and homeostatic reflexes maintain the osmotic set-point by promoting salt/water intake or excretion. For such reflexes to function effectively, osmoreceptors are required to detect changes in ECF osmolality. Central osmoreceptive neurons located in brainstem nuclei that largely lack a blood-brain barrier play a crucial role in osmoregulation (Bourque, 2008).