Primary hepatocytes were plated in 100 mm collagen-coated plates at 2.4 million cells/plate. Matrigel (Cat. no. 354234) was obtained from BD Biosciences. After the 2-hour attachment period hepatocytes

were treated as follows: (1) HGM medium with growth factors and 0.233 mg/mL Matrigel (+MTG+GF); (2) HGM without growth factors and 0.233 mg/mL Matrigel (+MTG−GF); (3) HGM with growth factors but no Matrigel (−MTG+GF); and (4) HGM without growth factors and without Matrigel (−MTG−GF). Plates were harvested on days 2, 6, and 10 for RNA. Standard PCR was performed using 50 ng cDNA and Amplitaq RAD001 ic50 DNA polymerase (Applied Biosystems). PCR products were resolved on 2% agarose gels and

visualized with ethidium bromide staining. The bands on gel were scanned for optical density using ImageJ software for quantitation purposes. Short hairpin RNA (shRNA) for REST: we used a commercially available kit from Invivogen (Cat. CHIR-99021 in vivo no. ksirn4-gz21) to generate the plasmid containing shRNA targeted against REST. The shRNA vector employed also encodes a red-shifted variant of the jellyfish GFP. This plasmid is specifically designed for the cloning of small synthetic oligonucleotides that encode two complementary sequence of 21 nt, homologous to a segment of REST. The insert is cloned downstream of a human 7SK promoter. It is transcribed into a short double-strand RNA (dsRNA) with a hairpin structure (shRNA) consisting of a 21 basepair double-stranded 上海皓元医药股份有限公司 region corresponding to REST and a small loop formed by the spacer region. Sequences for REST shRNA insert: Forward: 5′-ACC TCTTGGTGAAGAGAGACAGATTC AAGAGATCTGTCTCTCTTCACC AAT T-3′; Reverse: 5′-CAAAAATTGGTGAAGAGAGACAGATC TCTTGAATCTGTCTCTCTTCAC CAA G-3′. Primary hepatocytes were plated at a density of 1 × 106 cells per 100 mm dish or 0.25 × 106

cells per well (6-well plate) on day 1. After the 2-hour attachment period, plating media was replaced with HGM complete without growth factors. On the second day hepatocytes were either transfected with shRNA for luciferase (C), or shRNA for REST (R). The transfection media was replaced with fresh HGM without growth factors after 6 hours. On the next day (day 3) media was changed to HGM with growth factors and thereafter replaced every 48 hours throughout the time course. Cells were harvested at days 0, 1, 2, 3, 4, and 5 after transfections for RNA and protein. MTT assay was done on days 2, 3, 4, and 5 as a marker of live cells. Tritiated thymidine incorporation was measured on days 1-2 after transfections to assess proliferation of hepatocytes.